INFORMATION: 
READ & LOOK AT ALL BELOW !

 

***  NOTE:   USE Translation APP, as need, Use the Photo Mode and take photo and see translation. Translation it not 100% Accurate.

S1

English:  http://dradama.com/docs/V-0224-001e.jpg

Chinese:  http://dradama.com/docs/V-0224-001.jpg

Prevention and control of novel coronavirus pneumonia

(Fifth Edition)

The novel coronavirus belongs to the coronavirus, and its genetic characteristics are obviously different from those of SARSr —Cov and MERSr —CoV. The virus is sensitive to UV and heat. The virus can be inactivated by 56 °C for 30 minutes, ether, 75% ethanol, chlorine containing disinfectant, peracetic acid and chloroform.

Novel coronavirus infection is the main cause of infection. The latent period is 1-14 days, and the results are 3-7 days.

Asymptomatic infections may also become infectious sources.

The main routes of transmission are respiratory droplets and contact transmission. Long time exposure to high concentration aerosol in relatively closed environment may lead to the spread of aerosol. Other routes of transmission have yet to be identified; people are generally susceptible.

Novel coronavirus pneumonia is included in novel coronavirus pneumonia pneumonia. In order to prevent and control the new coronavirus pneumonia, control the spread of the epidemic, reduce the mortality rate, safeguard the safety and health of the people, and maintain social stability, we should combine the new coronavirus pneumonia into class a management and precise strategy for the prevention and control of class a notifiable infectious diseases. Based on the fourth version of the prevention and control plan, this version of the plan is updated.

objective

ne eee pneumonia cases were found and reported in time to understand the cheracteristics and bursts of

1E

S2

English:  http://dradama.com/docs/V-0224-002e.jpg

Chinese:  http://dradama.com/docs/V-0224-002.jpg

Novel coronavirus should be exposed to history, regulate the management of close contacts, guide the public and specific groups to do personal protection, strictly disinfect specific places, and accurately and scientifically and categorize guidance, effectively curb the spread of the epidemic and reduce the harm of new coronavirus infection to public health.

2. Scope of application

It is applicable to guiding local governments to carry out prevention and control work. The program will be updated in time according to the change of epidemic situation and assessment results.

3. Prevention and control measures

(1) Improve prevention and control mechanism and strengthen organizational leadership :

The novel coronavirus pneumonia epidemic prevention and control work is highly valued. The novel coronavirus, the Ministry of health and health administration, under the leadership of the government at the same level, strengthens the guidance for the local epidemic prevention and control work, and sets up the prevention and control technology expert group. In accordance with the principle of “prevention, prevention, and control, scientific guidance and timely treatment", the relevant departments are organized to formulate and perfect relevant work and technical plans, so as to standardize and carry out the prevention and control of new coronavirus pneumonia.

Strengthen joint prevention and control, strengthen information exchange and measure interaction between departments, regularly discuss and judge the epidemic development trend, and agree on prevention and control policies.

The administrative departments of health and health at all levels shall be responsible for the overall guidance of epidemic control and the implementation of prevention and control funds and materials. Disease control institutions at all levels are responsible for organizing, coordinating, supervising and evaluating the monitoring work, collecting, analyzing, reporting and feeding back the monitoring data, conducting an on-site investigation, laboratory testing and professional technical training, conducting health education and risk communication to the public, guiding the personal protection of the public and specific groups, and guiding the development of specific groups

2E

S3

English:  http://dradama.com/docs/V-0224-003e.jpg

Chinese:  http://dradama.com/docs/V-0224-003.jpg

Disinfection of the site. All kinds of medical institutions at all levels are responsible for the discovery, report, isolation, diagnosis, treatment and clinical management of cases, the collection of specimens, the training of medical personnel in their own institutions, and the prevention and control of nosocomial infection.

(2) Scientific classification of epidemic risk level and accurate prevention and control at different levels.

In accordance with the law of the people's Republic of China on the prevention and control of infectious diseases, the regulations on the emergency response to public health emergencies and other laws and regulations, the implementation of accurate prevention and contro! by zones and levels was carried out. Taking the county (District) as the unit, according to the comprehensive study and judgment of population and disease situation, scientifically divide the epidemic risk level, and clarify the prevention and control strategy of classification.

Low risk areas implement the strategy of “external defense input”. We will strengthen the follow-up and management of the inflow of people in areas with severe epidemics and high-risk areas, and do a good job in health monitoring and services. Medical institutions should strengthen the monitoring, detection and reporting of fever outpatients, and disease control institutions should promptly carry out epidemiological investigation and follow-up management of close contacts. Urge and guide urban and rural communities, government agencies, enterprises and institutions to strictly implement community prevention and control measures, do a good job in environmental health remediation, and popularize public disease prevention knowledge and protection skills.

In the middle risk areas, the strategy of “external input prevention and internal proliferation prevention" is implemented. On the basis of various measures taken in low-risk areas, make preparations for medical treatment, disease prevention and control related personnel, materials, places, etc., and conduct isolation medical observation and management for close contacts of cases. With the schoo! class, building unit, factory workshop, workplace office as the smallest unit, with case discovery, epidemiological investigation and epidemic analysis as clues, reasonably determine the place and personnel for prevention and control management, and implement targeted prevention and control measures. No diagnosis

3E

S4

English:  http://dradama.com/docs/V-0224-004e.jpg

Chinese:  http://dradama.com/docs/V-0224-004.jpg

The township, street and urban and rural community of the case can take control measures with reference to low-risk areas.

In high-risk areas, the strategy of "internal non-proliferation, external non-export and strict control" is implemented. On the basis of taking various measures in medium risk areas, stop gathering activities, and implement regional traffic control after examination and approval according to procedures. Take the county as a unit, comprehensively check the fever patients, timely treat and manage the suspected cases, confirmed cases and asymptomatic infections, and conduct isolation medical observation on the close contacts. Disinfect relevant places in urban residential areas (rural natural villages) where community-based transmission or clustering epidemic occurs, and take control measures such as limiting personnel aggregation and access.

Carry out dynamic analysis and judgment, adjust the risk level in a timely manner, and reduce the emergency response level or terminate the emergency response in different regions in a timely manner after the number of cases remains stable and the risk of epidemic spread is effectively controlled.

(3) Discovery and report of cases and emergencies.

The novel coronavirus novel coronavirus case monitoring program

(Annex 1) at all levels of medical institutions and CDC carries out monitoring, discovery, and reporting of the new coronavirus pneumonia cases and asymptomatic infections.

1. Case finding. In the novel coronavirus pneumonia novel coronavirus surveillance and daily diagnosis and treatment, all kinds of medical institutions should raise awareness of the diagnosis and report of new coronavirus pneumonia cases. For cases with a fever of unknown origin or dry cough and shortness of breath, they should pay attention to whether there are any travel history or residential history in Wuhan and surrounding areas within 14 days before onset or other cases reported. Have you ever been exposed to the fever in the above areas or communities

4E

S5

English:  http://dradama.com/docs/V-0224-005e.jpg

Chinese:  http://dradama.com/docs/V-0224-005.jpg

Novel coronavirus infection is associated with patients with respiratory symptoms.

The grass-roots organizations with travel or residence history of Wuhan city and its surrounding areas in nearly 14 days, or other communities with case reports, and with respiratory symptoms, fever, chills, fatigue, diarrhea, conjunctival congestion, and other symptoms, shall be screened as the key risk population and sampled and tested by professional institutions.

2. Case report. When novel coronavirus pneumonia suspected case, a confirmed case, and asymptomatic infection were found, medical institutions with direct reporting conditions should immediately report directly to the network. If it does not have the conditions for direct network reporting, it shall immediately report to the local county (District) level disease control institution and send out the infectious disease report card within 2 hours. The county (District) level disease control institution shall immediately make direct network reporting after receiving the report. The novel coronavirus pneumonia surveillance program should be revised according to the laboratory test results and the progress of the disease.

3. Discovery and report of emergencies. The first novel coronavirus pneumonia novel coronavirus pneumonia case in each county (District) and a confluent epidemic case that is in line with the new type coronavirus pneumonia case monitoring plan should be directly monitored by the CDC within 2 hours through the report management information system of public health emergencies. The severity level of the disease can be selected first without grading. According to the investigation and follow— up the progress of the incident and the risk assessment results, the health

5E

S6

English:  http://dradama.com/docs/V-0224-006e.jpg

Chinese:  http://dradama.com/docs/V-0224-006.jpg

 (4) Epidemiological investigation.

Novel coronavirus pneumonia suspected cases, novel coronavirus pneumonia cases and asymptomatic infections were reported by the

county or district level medical institutions or medical staff in the area.

After the epidemic situation was gathered, the epidemiological an investigation should be completed within 24 hours according to the new epidemiological survey plan for coronavirus pneumonia (Appendix 2).

After the county (District) CDC completes the case investigation of confirmed cases and asymptomatic infected persons, it shall report the case investigation form through the infectious diseases network report information system within 2 hours.

(5) Sample collection and detection.

The medical institutions receiving the cases shall collect the clinical specimens related to the cases in time, and send the specimens to the local designated disease control institutions or medical institutions or the laboratories of the third-party testing institutions as soon as possible for the relevant pathogen detection (Annex 4). The organization responsible for the testing work shall practically strengthen the biological safety protection and carry out the testing work in strict accordance with the biological safety regulations of the laboratory.

The collected clinical specimens include the patients’ upper respiratory tract specimens (such as nasopharynx swab, pharynx swab, etc.), lower respiratory tract specimens (such as deep expectoration fluid, alveolar lavage fluid, bronchial lavage fluid, respiratory tract aspirate, etc.), stool like / anal swab specimens, anticoagulant and serum specimens, etc. In order to improve the positive rate of nucleic acid test, we should try our best to collect the respiratory tract samples in the early stage of the disease, keep the sputum, collect the secretion of the lower respiratory tract during the tracheal intubation, and send the samples for examination as soon as possible after collection.

6E

S7

English:  http://dradama.com/docs/V-0224-007e.jpg

Chinese:  http://dradama.com/docs/V-0224-007.jpg

The collection, transportation, storage and detection of specimens shall be temporarily managed according to class Il highly pathogenic microorganisms, and shall be carried out in accordance with the regulations on biosafety management of pathogenic microorganism laboratories, the regulations on the management of the transportation of highly pathogenic microorganisms (toxins) or samples that can infect human beings (order No. 45 of the Ministry of Health) and other relevant requirements.

(6) Case treatment and prevention and control of nosocomial infection.

Medical institutions that need novel coronavirus pneumonia cases in designated medical institutions should be treated in cases. We should do a good job in ensuring the personnel, drugs, facilities, equipment and protective supplies needed for medical treatment.

Novel coronavirus infection prevention and control technical guidelines (First Edition) of medical institutions should be emphasized and strengthened in accordance with the requirements of the "technical guidelines for the prevention and control of new coronaviruses in medical institutions”. Novel coronavirus pneumonia should be isolated from the suspected cases and confirmed cases. The suspected cases should be isolated by single room isolation. The new standard coronavirus pneumonia diagnosis and treatment plan (trial version sixth) (the National Health Office medical service No. 2020) 145 is required to be disconnected and discharged. Asymptomatic patients should be isolated for 14 days. In principle, the nucleic acid of two consecutive samples should be negative The isolation can be released after sex (sampling time interval of at least 1 day).

Medical institutions shall clean and disinfect medical devices, polluted articles, object surfaces and floors in strict accordance with technical specifications for disinfection of medical institutions

7E

S8

English:  http://dradama.com/docs/V-0224-008e.jpg

Chinese:  http://dradama.com/docs/V-0224-008.jpg

Air disinfection is required in the management code for air purification of the hospital. The medical waste generated novel coronavirus pneumonia patients should be disposed and managed in accordance with the regulations on the management of medical waste and the regulations on the management of medical wastes in medical and health institutions.

(7) Tracking and management of close contacts.

The county (District) administrative department of health shall organize and implement the tracking and management of close contacts with relevant departments. Intensive isolation medical observation shall be carried out for close contacts. In areas without conditions, isolation medical observation at home shall be carried out. Body temperature shall be measured at least twice a day, and whether there are acute respiratory symptoms or other related symptoms and disease progress shall be inquired. The medical observation period of close contacts was 14 days after the last contact with the case or asymptomatic infected person. Specific requirements refer to novel coronavirus pneumonia case close contact management plan (Annex 3)

(8) Strengthen the prevention and control of key places, institutions and people.

Strengthen the working mechanism of multi department joint prevention and control, minimize public gathering activities, and implement measures such as ventilation, disinfection and temperature monitoring for public places such as stations, airports, wharves, shopping mails, public toilets and closed vehicles such as cars, trains and airplanes according to local conditions After the resumption of work and production, the company shall guide the company to organize the employees to return to work in an orderly manner, do well in ventilation, disinfection, temperature detection and other prevention and control work, provide necessary personal protective equipment for the employees, and take the methods of operation in different areas, dining in different places to effectively reduce personnel aggregation. Guide well

8E

S9

English:  http://dradama.com/docs/V-0224-009e.jpg

Chinese:  http://dradama.com/docs/V-0224-009.jpg

Health education for migrant workers and temperature detection before returning to work, in case of any abnormal situation, timely report for disposal, strengthen investigation and identification, and prevent the risk personnel from going out.

After the schools and kindergartens return to school, they should guide the health prompt and health management of the returned teachers and students, and urge the implementation of prevention and control measures such as entrance Exhibition (noon) inspection and disease-related absence (attendance) cause tracing and registration. After receiving the epidemic report, carry out epidemiological investigation and epidemic treatment in time, and guide the regional disinfection.

Guide the special institutions such as pension institutions, welfare institutions for the disabled and supervision places to further standardize the management of personnel in and out, strictly enforce the hygiene measures such as ventilation, daily cleaning and disinfection, strengthen personal protection, health monitoring and management, and do a good job in the daily management of disabled and semi disabled people.

(9) Disinfect the specific places in time.,

Timely disinfect the places where the cases and asymptomatic infected people have lived, such as the sick home, isolation ward of medical institutions, transfer tools, medical observation places and other specific places. If necessary, evaluate the disinfection effect of the object surface, air and hands in time (Annex 5).

(10) Publicity, education and risk communication,

Actively carry out public opinion monitoring, popularize the knowledge of epidemic prevention and control, carry out group prevention and control, timely explain doubts to the public, respond to social concerns, and do a good job in communication of epidemic prevention and control risks. We should strengthen health education and risk communication for key groups, key places and large- scale crowd gathering activities, especially through various ways to do a good job in personal defense for the public and specific groups

9E

S10

English:  http://dradama.com/docs/V-0224-010e.jpg

Chinese:  http://dradama.com/docs/V-0224-010.jpg

Guidance on nursing to reduce possible contact or exposure in the population (attachment 6). In different stages of the epidemic development, through the analysis of the psychological changes and key information of the public, the health education strategy was adjusted in time, and the corresponding popular science propaganda was organized in time.

(11) Strengthen professional training and related research

The training of novel coronavirus pneumonia cases, epidemiological investigation, specimen collection and testing, medical treatment and prevention, personal prevention, etc. should be carried out by professionals in medical and health related institutions. According to the needs of prevention and control work, qualified medical and health institutions can carry out investigation and Research on disease transmission characteristics, clinical characteristics, strategy evaluation, etc., to provide scientific evidence for optimizing prevention and control strategies.

Attachment: 1. novel coronavirus pneumonia surveillance program

2. epidemiological investigation of novel coronavirus pneumonia cases

3. management of novel coronavirus pneumonia cases with close contacts

4. laboratory guidelines for novel coronavirus pneumonia

5. Technical scheme for disinfection of specific places

6. Personal protection guidelines for specific groups

E10

S11

English:  http://dradama.com/docs/V-0224-011e.jpg

Chinese:  http://dradama.com/docs/V-0224-011.jpg

Annex 1

In order to guide novel coronavirus pneumonia cases in all localities, we should make early detection and early reporting, and prevent the spread of the epidemic.

|. purpose

(1) novel coronavirus pneumonia cases, infected persons and clustered cases were found and reported in time.

(2) grasp novel coronavirus infection epidemic characteristics, and timely determine the trend of occurrence and development of the epidemic.

2, Monitoring definition (a suspected case.)

Combined with the comprehensive analysis of the following epidemiological history and clinical manifestations:

1. Epidemiological history. .

(1) Within 14 days before the onset of the disease, there were travel or residence histories of Wuhan and its surrounding areas, or other communities with case reports;

2) novel coronavirus infected persons (positive for nucleic acid detection) had contact history within 14 days before onset.

(3) Within 14 days before the onset of the disease, they had contact with people from Wuhan and surrounding areas, or

11E

S12

English:  http://dradama.com/docs/V-0224-012e.jpg

Chinese:  http://dradama.com/docs/V-0224-012.jpg

Patients with fever or respiratory symptoms from the community with case reports; (4) Clustering: within two weeks, within a small range, such as family, office There were 2 or more cases of fever and / or respiratory symptoms in schools, classes and other places.

2. Clinical manifestations,

(1) Fever and / or respiratory symptoms;

(2) novel coronavirus pneumonia imaging features

(3) in the early stage of the disease, the total number of leukocytes was normal , or decreased, and the lymphocyte count was decreased. There was any 1 item in the history of epidemiology and any 2 items in the clinical manifestations. tf there is no clear epidemiological history, it is in line with 3 of the clinical manifestations.

(2) Confirmed cases.

Suspected cases with one of the following pathogenic evidences:

1. novel coronavirus nucleic acid positive novel coronavirus was detected by real-time fluorescence RT-PC, and 2. virus gene was sequenced, highly homologous to the known new coronavirus. .

(3) Asymptomatic infection.

Novel coronavirus was not detected in clinical specimens and respiratory tract specimens. It was found mainly through the investigation of the aggregated epidemic situation and the tracking investigation of the source of infection.

4) Clustering epidemic.

Aggregate epidemic refers to 2 or more confirmed cases or asymptomatic infections found in a small area (such as a family, a construction site, a unit, etc.) within 14 days, and there is the possibility of interpersonal transmission caused by close contact, or the possibility of infection caused by joint exposure.

12E

S13

English:  http://dradama.com/docs/V-0224-013e.jpg

Chinese:  http://dradama.com/docs/V-0224-013.jpg

Patients with fever or respiratory symptoms from the community with case reports;

(4) Clustering: within two weeks, within a small range, such as family, office

There were 2 or more cases of fever and / or respiratory symptoms in schools, classes and other places.

2. Clinical manifestations,

(1) Fever and / or respiratory symptoms;

(2) novel coronavirus pneumonia imaging features

(3) in the early stage of the disease, the total number of leukocytes was normal , or decreased, and the lymphocyte count was decreased. There was any 1 item in the history of epidemiology and any 2 items in the clinical manifestations.

If there is no clear epidemiological history, it is in line with 3 of the clinical manifestations.

(2) Confirmed cases.

Suspected cases with one of the following pathogenic evidences:

1. novel coronavirus nucleic acid positive novel coronavirus was detected by real-time fluorescence RT-PC, and 2. virus gene was sequenced, highly homologous to the known new coronavirus. .

(3) Asymptomatic infection.

Novel coronavirus was not detected in clinical specimens and respiratory tract specimens. It was found mainly through the investigation of the aggregated epidemic situation and the tracking investigation of the source of infection.

4) Clustering epidemic.

Aggregate epidemic refers to 2 or more confirmed cases or asymptomatic infections found in a small area (such as a family, a construction site, a unit, etc.) within 14 days, and there is the possibility of interpersonal transmission caused by close contact, or the possibility of infection caused by joint exposure.

13E

S14

English:  http://dradama.com/docs/V-0224-014e.jpg

Chinese:  http://dradama.com/docs/V-0224-014.jpg

After receiving the report, the county (District) disease control institution shall immediately make a direct network report and correct the follow-up information.

"Novel coronavirus pneumonia" was selected in the direct reporting diseases, and the "suspected cases", "confirmed cases" and "positive tests" were selected in the case classification. According to the novel coronavirus pneumonia diagnosis and treatment plan (trial version sixth), the "clinical severity" classification of suspected cases and confirmed cases is selected in the classification of the direct reporting system of the network, and the "light", "ordinary", "heavy" or "dangerous" categories are selected for reporting.

Positive test refers to asymptomatic infection, corresponding to asymptomatic infection in "clinical severity”.

A novel coronavirus was reported as "suspected cases" and "reported clinical cases (only Hubei province)". If the reported “asymptomatic infected person" has clinical manifestations, it shall be revised to "confirmed case" in time. For all cases, in the “clinical severity", timely correction is made according to the change of the condition, and the most serious state of the case is the final state.

When filling in “asymptomatic infected person", the "date of onset" is "collection time of positive specimen", and the "diagnosis date" is "positive detection time". For example, "asymptomatic infection" is revised to "confirmed case", and its "onset date" is the time of clinical symptoms.

(3) Event discovery and reporting.

According to the requirements of the national public health emergency plan and the national public health emergency information report management work specification (Trial), each county (District)

14E

S15

English:  http://dradama.com/docs/V-0224-015e.jpg

Chinese:  http://dradama.com/docs/V-0224-015.jpg

The first novel coronavirus pneumonia confirmed case and cluster epidemic appeared. The CDC should make a direct report in 2 hours through the report management information system of public health emergencies, and the event level can be selected first without grading. According to the investigation and follow-up progress of the incident and the risk assessment results, the health administration department can adjust the incident level accordingly, and report the initial, progress and closure reports of the incident directly on the Internet in a timely manner.

(4) Epidemiological investigation.

After receiving reports of novel coronavirus pneumonia suspected cases, confirmed cases and asymptomatic infectious diseases, the county (District) level CDC shall complete the case investigation within 24 hours and register the close contacts promptly. The novel coronavirus pneumonia novel coronavirus epidemiology survey plan and new coronavirus pneumonia case close contact management plan are included in the specific contents. After the county (District) CDC completes the case investigation, it shall timely report the case investigation information of confirmed cases and asymptomatic infected persons through the network direct reporting system.

(5) Sampte collection and laboratory testing.

The medical institutions receiving suspected cases shall collect relevant clinical samples of the cases, and send the samples to the local designated disease control institutions, medical institutions or third-party testing institutions as soon as possible for laboratory tests such as relevant etiology.

The collected clinical samples include patients' upper respiratory tract samples (such as nasopharynx swab, pharynx swab, etc.), lower respiratory tract samples (such as deep expectoration fluid, alveolar lavage fluid, bronchial lavage

15E

S16

English:  http://dradama.com/docs/V-0224-016e.jpg

Chinese:  http://dradama.com/docs/V-0224-016.jpg

Lotion, respiratory tract aspirates, etc.), fecal / anal swab samples, anticoagulant and serum samples, etc. In order to improve the positive rate of nucleic acid test, we should try our best to collect the respiratory tract samples in the early stage of the disease, keep the sputum, collect the secretion of the lower respiratory tract during the tracheal intubation, and send the samples for examination as soon as possible after collection.

Novel coronavirus pneumonia laboratory testing technical guide is required for clinical specimen collection and laboratory testing.

The collection, transportation, storage and detection of specimens shall be temporarily managed according to class Il highly pathogenic microorganisms, and shall be carried out in accordance with the regulations on biosafety management of pathogenic microorganism laboratories, the regulations on the management of the transportation of highly pathogenic microorganisms (toxins) or samples that can infect human beings (order No. 45 of the Ministry of Health) and other relevant requirements.

(6) Requirements for recheck of laboratory test results of clustered cases.

Novel coronavirus pneumonia in all regions should be sent to the China Center for Disease Control and prevention for review and confirmation. All the original specimens of 5 cases of new coronavirus pneumonia should be sent to the CDC for verification.

16E

S17

English:  http://dradama.com/docs/V-0224-017e.jpg

Chinese:  http://dradama.com/docs/V-0224-017.jpg

Annex 2

Epidemiological investigation of novel coronavirus pneumonia cases Novel coronavirus pneumonia cases are novel coronavirus pneumonia cases, such as the incidence of the disease, exposure history, contact history and other epidemiological information. We should closely investigate the close contacts and prevent the spread and spread of the new coronavirus pneumonia.

1, Purpose of investigation

(1) To investigate the incidence and treatment, clinical characteristics, risk factors and exposure history of the cases;

(2) Identify and manage close contacts.

2, Respondents

Novel coronavirus pneumonia suspected cases, confirmed cases and asymptomatic infections, as well as clustered epidemic.

3. Contents and methods of investigation

(1) Case study.

After receiving the report, the county (District) level disease control institution shall complete the epidemiological investigation within 24 hours, which can be carried out by means of consulting information, asking cases, insiders and receiving doctors. If the condition of the case allows, the case should be investigated first, and then the doctors, family members and informed persons should be investigated.

17E

S18

English:  http://dradama.com/docs/V-0224-018e.jpg

Chinese:  http://dradama.com/docs/V-0224-018.jpg

Novel coronavirus novel coronavirus pneumonia cases name list and gender information are included in the survey.

Investigation contents of confirmed cases and asymptomatic infected persons: basic information, morbidity and treatment, risk factors and exposure history, laboratory testing, close contacts, etc. see the attached table for details. The novel coronavirus pneumonia case is closely related to the management of the new coronavirus pneumonia case.

(2) Investigation of the epidemic situation.

Novel coronavirus pneumonia surveillance program is based on the direct report information and case investigation of the county and district level, and the investigation should be carried out immediately after determining the cluster epidemic situation. In addition to the source of infection, close contacts and other information of all cases, the investigation focuses on the epidemiological connection between cases, analysis of the transmission chain, and the results of the aggregated epidemic investigation. According to the requirements of the national public health emergency related information reporting management standard (Trial), the basic information, initial, progress and closure reports of the event shail be filled in. China's novel coronavirus pneumonia epidemiological survey guide is also available for investigation and analysis. The key information of the cluster epidemic cases is attached to the closing report.

4, Organization and implementation

According to the principle of “localized management”, the county (District) where the case medical institution is located

18E

S19

English:  http://dradama.com/docs/V-0224-019e.jpg

Chinese:  http://dradama.com/docs/V-0224-019.jpg

A novel coronavirus pneumonia case was investigated by the health and health administration department. The investigation unit shall promptly establish an on- site investigation team, define the purpose of the investigation and determine the composition of the investigation team and their respective responsibilities and division of labor in accordance with the investigation plan formulated. During the investigation, the investigators should do a good job in personal protection. The Centers for Disease Control and prevention at the municipal, provincial and national levels can rush to the scene according to the needs of epidemic treatment, and form a joint investigation team with the investigation institutions that arrived in the early stage to carry out the field epidemiological investigation.

5. Report and analysis of information

After the county (District) level disease control institutions have completed the case investigation of confirmed cases, asymptomatic infected persons or aggregate epidemic investigation, they shall report the case investigation forms and investigation reports through the network report system in time within 2 hours.

At the same time, the epidemiological investigation and analysis report shall be submitted to the health and health administration department at the same level and the disease control institution at the higher level.

Schedule: novel coronavirus pneumonia case questionnaire

19E

S20

English:  http://dradama.com/docs/V-0224-020e.jpg

Chinese:  http://dradama.com/docs/V-0224-020.jpg

Schedule

Novel coronavirus pneumonia case questionnaire

Guestionnsire Noy ID number:: _

1, Basic information

1. Name:

2. Gender: Male! me

2. Morbidity and treatment

3. Date of admission & | a |

4. Symptoms and signs on admission

Mouth heating: maximum temperature ° ct?

Mouth shivering, mouth coughing, mouth phlegm, mouth congestion, mouth runny, mouth sore, mouth pain, mouth weakness, oral volume

© paln in flight, sore mouth, joint, sore breath, good suction, difficult mouth, chest tightness im

Conjunctival congestion, nausea, vomiting, diarrhea, stomachache, stomachache, others

5. Time of blood routine test on admission: day .

Test results)

Tost rosutts: WEC [leukocyte number) 10° / L: (lymphocyte number) ) 10L

L (lymphocyte percentage) %; n (percentage of neutrophils) __%

6. Complications: oral No mouth

§ Yes, plese choose (multiple choices): oral meningitis, oral cerebral oral bacteremia / sepsis

Acute bung injury / ARDS acute renal injury wound disease

Oral secondary bacterial pneumonia oral others

7. Whether chest X-ray or CT examination has the imaging characteristics of

pneumonia: mouth meter test 0 no mouth if there is, test time: mm / DD / yyyy

3, Risk factors and exposure history

8. Whether the case is a specific occupational person: oral medical personnel, oral pathogenic .

microorganism detection personnel, oral wildlife contact with relevant personne!, oral poultry, livestock

breeding personnel, construction of elderly care institutions, others —

If It is a medical staff, please select a specific work place

Oral doctors and nurses C1 field staff of disease control and laboratory personnel 0 others

8. Whether the faithful are pragnent women: C) yes, pregnant week mouth fragrance

10. Former sick offciets (multiple choices avpitable):

No 0 high blood pressure, sugar and excrement disease, cardiovascular and cerebrovascular disease

20E

S21

English:  http://dradama.com/docs/V-0224-021e.jpg

Chinese:  http://dradama.com/docs/V-0224-021.jpg

0 chronic pulmonary disease (0 chronic obstructive pulmonary disease, oral other)

Ora! tumor (2 knee cancer 0 other} oral chronic nephropathy

O chronic liver disease 0 Immunodeficient diseases and others

ions ala ieee

11, Whether the case was found as a close contact during the isolation medica! view: Yes 0 no

12. Whether there is any travel history or residence history of residents in Wuhan and its surrounding areas, or other communities with case reports no

13. Have you ever been exposed to people with fever or respiratory symptoms from Wuhan city and surrounding areas, or from Du District with case report: 0 yes

Have you ever contacted any person who has a travel or residence history

of Wuhan city and its surrounding areas, or in any other community

18. Whether the case has contact history of confirmed case or asymptomatic infected person: 0 yes 0 no

16. Does the same family, work unit, kindergarten or school have clustering disease?

Whether the mouth is clear or not

4, Laboratory testing

17. Sample collection and detection of new coronary disease

Specimen type Sampling time detection regult

SEE PAGE 21 IMAGE

http://www.dradama.com/pic/V-0224-021e.jpg

21E

S22

English:  http://dradama.com/docs/V-0224-022e.jpg

Chinese:  http://dradama.com/docs/V-0224-022.jpg

MISSING TITLE SEE

http://www.dradama.com/pic/V-0224-022e.jpg

Annex 3

The novel coronavirus pneumonia case novel coronavirus was investigated and analyzed in order to guide the investigation and management of new coronavirus pneumonia cases and to effectively control the spread of the disease.

1, Judging principle

Close contacts refer to those who have no effective protection against close contact (within 1 meter) with suspected cases and confirmed cases from 2 days before the symptoms appear, or from 2 days before the sampling of asymptomatic infected samples. The specific contact conditions are as follows:

1. People who live, study, work together or have close contact with each other, such as working close together or sharing the same classroom or living in the same house

2. Medical staff, family members or other personnel who have similar close contact with diagnosis, treatment, and visiting cases, such as visiting or staying in a closed environment, other patients in the same room and their caregivers

3. Take the same vehicle and have close contact personnel, including nursing personnel, colleagues (family, colleagues, friends, etc.) on the vehicle, or other passengers and crew members who may have close contact with cases and asymptomatic infected persons after investigation and evaluation. See Table 1 for the determination method of close contact between different vehicles.

4. After investigation, the on-site investigators shall be judged as other persons who meet the requirements of close contact after assessment

22E

S23

English:  http://dradama.com/docs/V-0224-023e.jpg

Chinese:  http://dradama.com/docs/V-0224-023.jpg

A standard setter,

The close contacts of novel coronavirus cases were registered with the new close list of coronavirus pneumonia cases (Schedule 2).

2, Management requirements

(1) Contact management.

The local health administrative departments shall together with the relevant departments, organize and implement the medical observation of close contacts. Those who refuse to perform may be assisted by the local public security organ to take compulsory isolation measures 1. When carrying out a medical observation, the reasons, time limit, legal basis, precautions and disease-related knowledge of medical observation shall be informed in writing or orally, as well as the medical and health institutions in charge of medical observation, their contact persons and contact information.

2. Close contacts should’ adopt centralized isolation medical observation, and those areas without conditions can adopt home isolation medical observation, and strengthen the management of home observation objects.

The duration of medical observation is 14 days after the last contact with the case or asymptomatic infected person without effective protection. The close contact test between the confirmed cases and asymptomatic patients should be continued until the end of the observation period if the test is negative during the medical observation period.

3. Centralized or home-based medical observation objects should live relatively independently, reduce the contact with common residents as much as possible, do a good job in cleaning and disinfection of medical observation places, and avoid cross infection. For details, see the technical scheme for disinfection of specific places. It is not allowed to go out during the observation. If it is necessary to go out, it can only be approved by the medical observation management personnel,

23E

S24

English:  http://dradama.com/docs/V-024e.jpg

Chinese:  http://dradama.com/docs/V-024.jpg

And wear disposable surgical masks to avoid going to crowded places.

4. General contacts other than those who take the same means of transportation as airplanes, trains and ships and live, study and work together shall be informed of their health risks. Once they have respiratory tract infection symptoms such as fever, dry cough, diarrhea, conjunctival congestion and other symptoms, they shall be informed of their recent activity history.

(2) Measures during medical observation.

1. During medical observation, the following measures should be taken

(1) novel coronavirus pneumonia patients should be given a temperature measurement every morning and evening, and their health status should be asked. Fill out the registration form for close contacts of new coronavirus pneumonia cases (Schedule 3). The novel coronavirus novel coronavirus pneumonia case close medical contact observation daily report (Schedule 4) and the new daily daily statistical summary of the coronavirus pneumonia case close contacts medical observation (Schedule 5) are given for reference to the close contacts medical observation summary.

(2) Personnel performing medical observation shall do well in personal protection. See personal protection guide for specific population for protection measures

2. During the period of medical observation, any symptoms (including fever, chills, dry cough, expectoration, nasal congestion, runny nose, sore throat, headache, fatigue, muscle ache, joint ache, shortness of breath, dyspnea, chest distress, conjunctival congestion, nausea, vomiting, diarrhea and abdominal pain) of close contacts shall be reported to the local health department immediately, and

24E

S25

English:  http://dradama.com/docs/V-025e.jpg

Chinese:  http://dradama.com/docs/V-025.jpg

Send to designated medical institutions for diagnosis and treatment according to regulations, collect samples for laboratory testing and screening.

If the screening results are suspected cases and confirmed cases, medical observation shall be carried out for personnel in close contact with them.

3. At the end of the medical observation period, if there is no abnormal situation in close contacts, the medical observation shall be removed in time

(3) Centralized medical observation place.

1. The selection of centralized medical observation places and the requirements for internal facilities are as follows

(1) In principle, centralized medical observation sites should be relatively independent and far away from densely populated areas. No centralized isolation place shall be set up in medical institutions.

(2) The internal area of the centralized medical observation place shall be divided into living area, material supply area and medical observation area according to the needs, and the division marks shall be clear. The infrastructure to ensure the normal life of the centralized isolation personnel shall have ventilation conditions and meet the implementation of daily disinfection measures.

(3) The centralized medical observation site should provide a single living environment for close contacts, and provide an independent toilet.

(4) The best place for centralized medical observation is an independent septic tank. Before entering the municipal drainage pipe network, the sewage shall be disinfected; if there is no independent septic tank, the sewage shall nbe collected in a special container, and then discharged after disinfection.

The disinfection method shall refer to the feces and sewage disinfection method in the technical scheme for disinfection of specific places.

3. Information filling

Encourage county (District) level disease control institutions to release close contacts after medical observation,

E25

S26

English:  http://dradama.com/docs/V-026e.jpg

Chinese:  http://dradama.com/docs/V-026.jpg

Novel coronavirus pneumonia novel coronavirus pneumonia case close contact investigation and control center issued by the China Center for Disease Control and prevention issued "new coronavirus pneumonia case close contacts investigation management guide (trial version)" (Zhong Chi Chuan transmission prevention and development (2020) 14)

Attached table: 1. Guidelines for judging close contacts of vehicles

2. novel coronavirus novel coronavirus pneumonia case close contact registration form 3. new coronavirus pneumonia case close contact medical view

Registration form

4. novel coronavirus pneumonia case close contact medical observation statistics daily report

5. novel coronavirus pneumonia case close contact medical observation daily summary sheet

26E

S27

English:  http://dradama.com/docs/V-027e.jpg

Chinese:  http://dradama.com/docs/V-027.jpg

Schedule 1

Guidelines for judging close contacts of vehicles

|. aircraft

1. Generally, all passengers in the same row and three rows in front and back of the case seats in the civil aircraft cabin, as well as the flight attendants who provide the cabin service in the above areas, shall act as close contacts.

Other passengers on the same flight are the general contacts.

2. Take a civil aircraft without high-efficiency particulate filter, and all personnel in the cabin.

3. Other persons known to have close contact with the case.

2, Railway passenger train

1. All the passengers and crew members who are on the hard —seat, hard sleeper or soft sleeper with the same compartment.

2. Passengers in the same soft sleeper compartment, or in the same hard seat (hard sleeper) compartment, and the crew serving the area.

3. Other persons known to have close contact with the case.

Three, automobile

1. When taking a fully sealed air-conditioned bus, the owner of the same bus with the case

27E

S28

English:  http://dradama.com/docs/V-028e.jpg

Chinese:  http://dradama.com/docs/V-028.jpg

Member

2. When taking a ventilated ordinary bus, passengers and drivers in the front and rear three rows of seats in the same bus with the case.

3. Other persons known to have close contact with the case.

Four, steamship

All personnel in the same cabin with the case and -crew members providing services for the cabin.

If the patient has severe symptoms such as high fever, sneezing, coughing and vomiting during contact with the case, it should be regarded as a close contact regardless of the time.

28E

S29

English:  http://dradama.com/docs/V-029e.jpg

Chinese:  http://dradama.com/docs/V-029.jpg

SEE IMAGE 29

http://www.dradama.com/pic/V-0224-029e.jpg

29E

S30

English:  http://dradama.com/docs/V-030e.jpg

Chinese:  http://dradama.com/docs/V-030.jpg

SEE IMAGE 30

http://www.dradama.com/pic/V-0224-030e.jpg

30E

S31

English:  http://dradama.com/docs/V-031e.jpg

Chinese:  http://dradama.com/docs/V-031.jpg

SEE IMAGE 31

http://www.dradama.com/pic/V-0224-031e.jpg

31E

S32

English:  http://dradama.com/docs/V-032e.jpg

Chinese:  http://dradama.com/docs/V-032.jpg

SEE IMAGE 32

http://www.dradama.com/pic/V-0224-032e.jpg

32E

S33

English:  http://dradama.com/docs/V-033e.jpg

Chinese:  http://dradama.com/docs/V-033.jpg

Annex 4

[novel coronavirus pneumonia

In order to guide novel coronavirus pneumonia laboratory tests at all levels of disease control departments and other relevant institutions, we have formulated this technical guide.

1, Specimen collection

(1) Collection object,

Novel coronavirus pneumonia novel coronavirus cases and clustered cases require new coronavirus infection diagnosis or differential diagnosis, or other environmental or biological materials that need further screening and testing.

(2) Specimen collection requirements

1. the novel coronavirus test specimen collection technicians should undergo biosafety training (training qualified) and have corresponding experimental skills. Personal Protective Equipment (PPE) requirements of sampling personnel: N95 and above protective mask, goggles, integrated protective clothing, double layer latex gloves, waterproof boot cover; if contact with the patient's blood, body fluids, secretions or excreta, the outer layer latex gloves shall be replaced in time.

2. The samples of inpatient cases are collected by the medical staff of the hospital.

3. The samples of close contacts shall be in the charge of the local designated disease control institutions and medical institutions

Collection.

4. According to the needs of laboratory testing, multiple samples can be taken in combination with the course of disease.

33E

S34

English:  http://dradama.com/docs/V-034e.jpg

Chinese:  http://dradama.com/docs/V-034.jpg

 (3) Species of specimens collected. , Each case must collect respiratory samples (including upper respiratory samples or lower respiratory samples) in acute stage, and in severe cases, lower respiratory samples are preferred; stool samples, whole blood samples and serum samples can be reserved according to clinical needs.

Specimen type:

1, Upper respiratory tract specimen: including nasopharynx swab, pharynx swab, etc.

2. Lower respiratory tract specimens: deep expectoration fluid, alveolar lavage fluid, broncholavage fluid, respiratory tract aspirates, etc.

3. Stool sample: take about 10 g (peanut size) of stool sample.

If it is not convenient to take stool sample, take anal swab.

4. Blood sample: try to collect the acute anticoagulant within 7 days after the onset of the disease, with a collection volume of 5m/1. It is recommended to use a vacuum blood collection vessel containing EDTA anticoagulant to collect blood.

5. Serum samples: try to collect two serum samples in acute and recovery period.

The first serum should be collected as early as possible (preferably within 7 days after the onset of the disease), and the second serum should be collected at 3-4 weeks after the onset of the disease. The collection volume is 5m/. It is recommended to use a vacuum blood collection vessel without anticoagulant.

Serum samples are mainly used for the determination of antibodies without nucleic acid detection.

(4) Collection and treatment of specimens.

1. Nasopharynx swab: the sampling personnel gently hold the head of the collected personnel with one hand and swab with the other hand. The swab sticks to the nostril and enters, slowly and deeply along the bottom of the lower nasal tract. Because the nasal tract is arc-shaped, do not use too much force to avoid trauma and bleeding. When the top of the swab reaches the posterior wall of the nasopharynx cavity, rotate it slightly for a week (if you have a reflex cough, stop for a moment), then slowly take out the swab, and immerse the swab head into the virus containing 2-3m for preservation

34E

S35

English:  http://dradama.com/docs/V-035e.jpg

Chinese:  http://dradama.com/docs/V-035.jpg

in the tube of solution (isoosmotic salt solution, tissue culture solution or phosphate buffer can also be used), discard the tail and tighten the tube cover.

2. Pharyngeal swab: the collected person rinses his mouth with normal saline first, and the sampling person puts the swab into sterile saline to moisten it (it is forbidden to put the swab into the virus preservation solution to avoid the allergy caused by antibiotics). The collected person tilts his head slightly,  opens his mouth wide, and then "ah" sounds, exposing the pharyngeal tonsils on both sides, passing the swab over the root of the tongue, and wiping the pharyngeal tonsils on both sides of the collected person back and forth at least 3 times, Then wipe the back pharyngeal wall up and down for at least 3 times, immerse the swab head into the tube containing 2-3ml virus preservation solution (isoosmotic salt solution, tissue culture solution or phosphate buffer can also be used), discard the tail, and tighten the tube cover. The throat swab can also be placed in the same tube as the nasopharynx swab.

3. Nasopharynx extract or respiratory tract extract: use the coilector connected with negative pressure pump to extract mucus from nasopharynx or respiratory tract secretion from trachea. Insert the head of the collector into the nasal cavity or trachea, connect the negative pressure, rotate the head of the collector and exit slowly, collect the extracted mucus, and wash the collector with 3M1 sampling solution once (or connect the pediatric catheter to the 50ml syringe to replace the collector)

4. Deep expectoration fluid: after the patient has deep cough, the expectoration fluid shall be collected in a 50m1 screw mouth plastic tube containing 3ml of sampling fluid. if the soutum is not collected in the sample solution, add 2 ~ 3M1 sample solution, or add the volume of sputum digestion solution such as sputum before the test. Formula of sputum digestive fluid storage solution:

component Each bottte

Dithiothreitol

sodh

chord 0.78g .

chloride 0.02g

35E

S36

English:  http://dradama.com/docs/V-036e.jpg

Chinese:  http://dradama.com/docs/V-036.jpg

Disodium

ohoaptate 0.112g

phosphate 0.02g

wate 7.5m

pH7.440.2(25'°C)

Dilute the storage solution to 100m! with deionized water before use The same volume of sputum containing 1g / L protease K phosphate buffer can also be used to liquefy sputum.

5. Broncholavage fluid: insert the collector head into the trachea (about 30cm deep) from the nostril or trachea socket, inject 5m1 saline, connect the negative pressure, rotate the collector head and exit slowly. Collect the extracted mucus and wash the collector with sampling solution once (it can also be replaced by connecting the pediatric catheter with a 50m syringe)

6. Alveolar lavage fluid: after local anesthesia, insert the fiberbronchoscope through the mouth or nose through the pharynx into the branch pipe of the middle lobe of the right lung or the left lung tongue segment, wedge its top into the branch opening of the bronchus, slowly add sterile physiological saline through the biopsy hole of the air pipe, 30-50ML each time, 100-250ml in total, no more than 300ml.

7. Fecal specimen: take 1m1 of sample treatment solution, take the fecal specimen with the size of soybean granules and add it into the tube, gently blow and suck it for 3-5 times, leave it at room temperature for 10 minutes, centrifugate it at 8000rpm for 5 minutes, and then suck the supernatant for detection.

Fecal sample treatment solution can be prepared by yourself: 1.2119 Tris, 8.5g

sodium chloride, 1.1g anhydrous calcium chloride or 1.47g calcium chloride with crystal water, dissolved into 800m! deionized water, adjusted pH value to  7.5 with concentrated hydrochloric acid, supplemented to 1000ml with deionized water %

36E

S37

English:  http://dradama.com/docs/V-037e.jpg

Chinese:  http://dradama.com/docs/V-037.jpg

The stool suspension can also be prepared by dissolving the stool sample with Hanks solution or other isotonic salt solution, tissue culture solution or phosphate buffer solution. If the patient has diarrhea symptoms, take 3-5ml of stool samples, gently blow and mix them, centrifugate them at 8000rpm for 5min, and draw the supernatant for standby.

7. Anal swab: gently insert the sterile cotton swab into the anus for 3-5cm, then gently rotate and pull it out, and immediately put it into the 15ml external spiral cap sampling tube containing 3-5ml virus preservation solution, discard the tail, and tighten the cap.

8. Blood sample: it is recommended to collect 5m1 blood sample with vacuum blood collection vessel containing EDTA anticoagulant. According to the type of selected nucleic acid extraction reagent, the whole blood or plasma is used for nucleic acid extraction. If the plasma needs to be separated, the whole biood is centrifuged at 1500-2000 RM for 10 minutes, and the supernatant is collected in a sterile screw mouth plastic tube.

9. Serum samples: blood samples were collected by vacuum negative pressure blood collection vessel for 5m1, kept at room temperature for 30 minutes, centrifuged at 1500-2000 rpm for 10 minutes, and collected in sterile screw mouth plastic tube.

Other materials: collected according to the design requirements and specifications.

(5) Specimen packaging.

After collection, the specimens are repacked in the biosafety cabinet of the biosafety secondary laboratory. '

1. All specimens shall be placed in a sample collection tube with gasket and freezing resistance in a suitable size spiral cover and tightened. The container shall be marked with sample number, type, name and sampling date.

2. Put the sealed specimen into a sealed bag, one specimen for each bag. The sample packaging requirements shall conform to the corresponding standards of the technical rules for the safe transportation of dangerous goods by air.

37E

S38

English:  http://dradama.com/docs/V-038e.jpg

Chinese:  http://dradama.com/docs/V-038.jpg

3. If external specimen transportation is involved, three-layer packaging shall be carried out according to specimen type and infectious substances of class A or class B.

(6) Specimen preservation,

The samples used for virus separation and nucleic acid detection shall be detected as soon as possible, and the samples that can be detected within 24 hours can be stored at 4 °C; the samples that cannot be detected within 24 hours shall be stored at 70 °C or below (if there is no — 70 °C storage condition, they shall be temporarily stored in - 20 °C refrigerator). Serum can be stored at 4 °C for 3 days and can be stored for a long time under ~ 20 °C. A special storehouse or counter should be set up to keep the specimens separately. Repeated freezing and thawing should be avoided during specimen transportation.

(7) Sample submission

Samples should be sent to the laboratory as soon as possible after collection.

If long-distance transportation is needed, it is recommended to use dry ice and other refrigeration methods for preservation.

1. Submit specimen

Samples of clustered cases from all provinces (autonomous regions, municipalities directly under the central government) shall be submitted to the Institute of viral disease prevention and control of the China Center for Disease Control and prevention for detection and review, and attached with the sample inspection form (see attached table).

2. Pathogen and specimen transportation

2.1 domestic transportation

The transport packaging classification novel coronavirus strain or other potentially infectious biomaterial belongs to class A. the corresponding United Nations code is UN2814, which is in line with the Pi602 classification packaging requirements of the International Civil Aviation Organization document Doc9284 technical regulations for the safe transport of dangerous goods. The environmental samples belong to the B category, and the corresponding United Nations number is UN3373. The packaging conforms to the document doc9284 of the international civil aviation organization, safety transportation technology for dangerous goods by air

38E

S39

English:  http://dradama.com/docs/V-039e.jpg

Chinese:  http://dradama.com/docs/V-039.jpg

P650 classification packaging requirements of the detailed rules; for transportation through other means of transportation, please refer to the above standard packaging.

The transport of novel coronavirus strains or other potentially infectious materials should be handled according to the “Regulations on the management of highly pathogenic pathogenic bacteria (bacteria) or samples" of human infection (forty-fifth of the original health ministry).

2.2 international transportation

The novel coronavirus strains or samples should be packaged in international transportation, and the relevant procedures should be handled according to the regulations on the quarantine and hygiene of entry and exit special articles, and the relevant national and international requirements should be met.

2.3 strain and sample management

The novel coronavirus strains and their samples should be managed by special persons, accurately record the source, species and quantity of the strains and samples, numbering the registration numbers, taking effective measures to ensure the safety of the virus strains and samples, and strictly preventing misuse, malicious use, theft, robbery, loss, and leakage.

Two. Novel coronavirus laboratory test.

The novel coronavirus infection is routinely detected by real-time fluorescence RT-PCR. Any novel coronavirus detection must be performed in qualified laboratories by personnel trained by related technical safety. The novel coronavirus detection methods in this guide are mainly directed against the open reading frame Lab (open reading frame lab, ORF1ab) and core shell protein (nucleocapsid protein, N) in the new coronavirus genome.

Laboratory confirmation of a positive case requires one of the following two conditions:

1. the novel coronavirus 2 targets (ORFlab, N) were real-time in the same specimen.

39E

S40

English:  http://dradama.com/docs/V-040e.jpg

Chinese:  http://dradama.com/docs/V-040.jpg

The results of RT-PCR were all positive. If there is a single target positive test result, it needs to be resampled and retested. If it is still single target positive, it is determined to be positive.

2. If two kinds of real-time fluorescent RT-PCR samples show single target positive at the same time, or the same type of samples show single target positive in two sampling tests, it canbe determined as positive.

A novel coronavirus infection can not be ruled out by negative nucleic acid test results, and factors that may cause false negative are excluded. The samples are of poor quality, such as respiratory tract samples such as oropharynx, etc., and samples collected too early or too late; there is no correct preservation of transportation and processing samples; the reasons for the existence of the technology, such as virus variation, PCR inhibition, etc.

Three. Novel coronavirus nucleic acid detection by real-time fluorescence RT-PCR.

(1) Purpose.

Standard real-time fluorescence RT-PCR novel coronavirus nucleic acid detection procedures, to ensure that the experimental results are correct and reliable.

(two) scope

It is suitable for novel coronavirus aucleic acid detection by real-time fluorescence RT-PCR.

(3) Responsibilities.

Testing personnel: responsible for testing the tested samples in accordance with the testing rules. Reviewer: responsible for checking whether the test operation is standard and whether the test results are accurate

Make sure to recheck.

Department head: responsible for the review of the comprehensive management and test report of the Department. (4) Sample receiving and preparation

40E

S41

English:  http://dradama.com/docs/V-041e.jpg

Chinese:  http://dradama.com/docs/V-041jpg

Check the name, gender, age, number and test items of the sample to be tested; if there is any abnormality in the status of the sample to be tested, it shall be noted; the sample to be tested shall be stored in a refrigerator of — 70 °C

(5) Test items.

1. novel coronavirus nucleic acid determination (real-time fluorescence RT-PCR method)

Primers and novel coronavirus regions for ORFlab and N genes are recommended.

Probe.

Target — (orflab):

Forward primer (): ccctgtgggttttacacttaa

Reverse primer (R): acgattgtgcatcagctga

Fluorescence probe (P):

5-fam-ccgtctgcggtatgtggaaaggttatgg— |

bhq1-3 target 2 (n):

Forward primer (f): gggggaacttcctgctagaat

Reverse primer (R): cagacatttgctcacgtg

Fluorescence probe (P): 5—fam-—ttgctgctgcttgagatt-tamra 3

Reference correlation between nucleic acid extraction and real-time RT-PCR reaction system and reaction conditions:

Manufacturer's kit description.

2. Result judgment

Negative: no CT value or CT > 40.

Positive: CT value < 37, can be reported as positive

Gray area: CT value is between 37-40, it is recommended to repeat the experiment, if the result CT is repeated

41E

S42

English:  http://dradama.com/docs/V-042e.jpg

Chinese:  http://dradama.com/docs/V-042.jpg

The value is less than 40, the amplification curve has obvious peak, the sample is positive, otherwise it is negative. Note: if commercial kits are used, the instructions provided by the manufacturer shall prevail

4, Requirements for pathogen biosafety experiment activities According to novel coronavirus's biological characteristics, epidemiological characteristics, clinical data and other information, the pathogen is managed by second kinds of pathogenic microorganisms in the classification of pathogenic microorganisms.

(1) Virus culture.

Virus culture refers to the operation of virus isolation, culture, titration, neutralization test, purification of live virus and its protein, freeze- drying of virus and recombination experiment of producing live virus.

The above operations shall be carried out in the biosafety cabinet of biosafety level Ill laboratory. To extract nucleic acid from virus culture, the addition of lysate or inactivator must be carried out in the same level of laboratory and protection conditions as virus culture. After the addition of lysate or inactivator, the operation can be carried out according to the protection level of the uncultured infectious materials.

Before carrying out relevant activities, the laboratory shall report to the national health and Health Commission for approval and obtain the qualification to carry out corresponding activities.

(2) Animal infection experiment.

Animal infection experiment refers to the experimental operations of infecting animals with live virus, sampling of infected animals, treatment and detection of infectious samples, special inspection of infected animals, treatment of excreta of infected animals, etc., which shall be operated in the biosafety cabinet of biosafety level Ill laboratory. Before carrying out relevant activities, the laboratory shall report to the national health and Health Commission for approval and obtain the qualification to carry out corresponding activities.

42E

S43

English:  http://dradama.com/docs/V-043e.jpg

Chinese:  http://dradama.com/docs/V-043.jpg

 ( (3) Operation of uncultured infectious materials.

The operation of uncultured infectious materials refers to the operation of virus antigen detection, serological detection, nucleic acid extraction, biochemical analysis, and clinical sample inactivation before the inactivation of uncultured infectious materials by reliable methods, which shall be carried out in the secondary Laboratory of biosafety, and the personal protection of the tertiary Laboratory of biosafety.

V. operation of inactivated materials i e

The nucleic acid test, antigen test, serological test, biochemical analysis and other operations of infectious materials or live viruses  after being inactivated by reliable methods shall be carried out in the biosafety secondary laboratory. Other operations, such as molecular cloning, which do not contain pathogenic live virus, can be carried out in the biosafety level i laboratory.

43E

S44

English:  http://dradama.com/docs/V-044e.jpg

Chinese:  http://dradama.com/docs/V-044.jpg

SEE IMAGE 44

http://www.dradama.com/pic/V-0224-044e.jpg

44e

S45

English:  http://dradama.com/docs/V-045e.jpg

Chinese:  http://dradama.com/docs/V-045.jpg

Annex 5

1, Principles of disinfection

(1) Scope and object determination

According to the results of epidemiological investigation, the scope, object and time limit of field disinfection were determined. The places where the cases and asymptomatic infected persons have lived, such as the isolation wards of families and medical institutions, and the transfer tools, should be disinfected at any time.

After the case is discharged or died, the asymptomatic infected persons should be disinfected at the end after the nucleic acid test turns negative.

(2) Method selection,

Medical institutions should try to choose disposable medical supplies, non disposable medical supplies should first choose pressure steam sterilization, and non heat-resistant items can choose chemical disinfectant or low- temperature sterilization equipment for disinfection or sterilization.

Disinfectants such as chlorine containing disinfectant and chlorine dioxide can be selected to wipe, spray or bubble disinfect the surface of environmental objects.

It is recommended to select effective disinfectants such as iodophor and hydrogen peroxide for hand and skin, or quick drying hand disinfectant for wiping and disinfection.

Disinfection of indoor air can be done by disinfectant disinfectant

such as peracetic acid, chlorine dioxide and hydrogen peroxide.

The disinfection products used shall meet the management requirements of the national health department.

 2. Disinfection measures

45E

S46

English:  http://dradama.com/docs/V-046e.jpg

Chinese:  http://dradama.com/docs/V-046.jpg

 (1) Disinfect at any time.

Disinfection at any time refers to the timely disinfection of articles and places polluted by cases and asymptomatic infected persons. The places where the patients have lived, such as families, isolation wards of medical institutions, medical observation places and transfer tools, etc., the pollutants discharged by the patients and the contaminated articles should be disinfected at any time. See the final disinfection for the disinfection methods. It is not recommended to spray and disinfect under some conditions. Ventilation (including natural ventilation and mechanical ventilation) measures can be taken in the isolated places of patients to maintain indoor air circulation. Ventilate 2-3 times a day for at least 30 minutes each time.

The qualified medical institutions should place the patients in the negative pressure isolation ward, the suspected cases should be  isolated in a single room, and the confirmed cases can be placed in the same room. The non negative pressure isolation ward shall be well ventilated, and can be ventilated (including natural ventilation and mechanical ventilation), or can be disinfected by circulating air disinfector. The air can also be disinfected by ultraviolet under unmanned conditions. When disinfected by ultraviolet, the exposure time can be extended to more than 1 hour. The medical staff and the accompanying staff should wash their hands and disinfect after the diagnosis, treatment and nursing work.

(2) Terminal disinfection.

Terminal disinfection refers to the thorough disinfection treatment after the infectious source leaves the relevant places, and it should be ensured that there is no pathogen in the places and all kinds of articles after terminal disinfection. The final disinfection objects include the pollutants (blood, secretion, vomit, excreta, etc.) discharged by patients and asymptomatic infected persons, and the objects and places that may be polluted. It is not necessary to carry out large-scale disinfection of outdoor environment (including air). There is no need to end up in the places where there are no obvious pollutants in the cases and asymptomatic infected people who have been active for a short time

46E

S47

English:  http://dradama.com/docs/V-047e.jpg

Chinese:  http://dradama.com/docs/V-047.jpg

Disinfection at the end.

1. patients.,

After the patient is hospitalized or dies, the terminal disinfection shall be carried out for the asymptomatic infected person after the negative turn of nucleic acid test, including: living room floor, wall, table, chair and other furniture countertops, door handles, patient's tableware (drinking) utensils, clothes, bedding and other daily necessities, toys, toilets, including toilets, etc.

2. Means of transportation.

After the patients and asymptomatic patients leave, they should  disinfect the means of transportation, including the inner wall of the cabin, seats, sleeper, tabletop and other surfaces, food and drink utensils, bedding (sleeping) utensils and other textiles, excreta, vomitus and their contaminated objects and places, as well as the toilets of trains and airplanes.

3. Medical institutions

After the daily work of fever clinic and infection clinic in medical institutions and isolation ward in the ward, the final disinfection shall be done after the case is hospitalized or died and the nucleic acid test of asymptomatic infected person turns negative, including:

ground, wall, table, chair, bedside cabinet, bedstead and other object surfaces, patient's clothes, bedding and other daily necessities and related diagnosis and treatment supplies, as well as indoor air, etc.

4. Final disinfection procedure.

The final disinfection procedure shall be carried out in accordance with Appendix A of general principles for disinfection of epidemic focus (gb19193-2015). Personal protection should be done well when preparing and using chemical disinfectants.

3, Disinfection methods of common pollution objects

47E

S48

English:  http://dradama.com/docs/V-048e.jpg

Chinese:  http://dradama.com/docs/V-048.jpg

 (1) Indoor air.

The terminal disinfection of the indoor air such as family, medical institution isolation wards can be referred to the hospital air purification management standard (WS/T368-2012). Under no conditions, disinfectants such as peracetic acid, chlorine dioxide and hydrogen peroxide can be selected for disinfection by ultra low volume spray method.

(2) Contaminants (patient's blood, secretions and vomitus)

A small amount of pollutants can be removed carefully by using disposable absorbent materials (such as gauze, duster cloth, etc.) stained with 5000mg/L~10000mg/L effective chlorine containing disinfectant (or disinfection wipes / kerchiefs that can reach a high level of disinfection).

A large number of pollutants shall be completely covered with disinfectant or bleaching powder containing water absorbing ingredients, or fully covered with disposable water absorbing materials, and then poured on the water absorbing materials with a sufficient amount of effective chlorine 5000mg / L ~ 10000mg / L chlorine containing disinfectant solution, acting for more than 30 minutes (or a disinfectant dry towel that can reach a high level of disinfection), and cleaned carefully. Avoid contact with pollutants during the removal process, and dispose the cleaned pollutants in a centralized way as medical wastes The secretions and vomitus of the patients should be collected in special containers and sterilized with effective chlorine 20000mg / L chlorine containing disinfectant in the proportion of 1:2 for 2h After the pollutants are removed, the surfaces of the polluted environmental objects shall be disinfected. Containers containing pollutants can be disinfected with effective chlorine 5000mg / L chlorine containing disinfectant solution for 30 minutes and then cleaned.

(3) Manure and sewage

Where there is an independent septic tank, disinfection is required before entering the municipal drainage pipe network

48E

S49

English:  http://dradama.com/docs/V-049e.jpg

Chinese:  http://dradama.com/docs/V-049.jpg

Regularly add chlorine containing disinfectant, add chlorine containing disinfectant in the tank (the first time, the effective chlorine is more than 40 mg / L), and ensure that the total residual chlorine amount reaches 10 mg / L after 1.5 hours of disinfection.

The disinfected sewage shall meet the discharge standard of water pollutants for medical institutions (gb18466-2005) When there is no independent septic tank, special containers shall be used to collect excreta, which shall be discharged after disinfection. Use the chlorine containing disinfectant with the effective oxygen of 20000mg / L to soak and disinfect for 2h according to the proportion of feces and medicine; if there is a large amount of diluted feces, use the bleaching powder with the effective chlorine of 70% — 80% to dry the powder, mix the powder according to the proportion of feces and medicine of 20:1 and disinfect for 2h

(4) Floor, wall.

When there are visible pollutants to the naked eye, the pollutants shall be completely removed before disinfection. When there is no visible pollutant, the effective oxygen 1000mg / L chlorine containing disinfectant or 500mg / L chlorine dioxide disinfectant can be used for wiping or spraying disinfection.

The ground disinfection shall be sprayed once from the outside to the inside, and the spraying amount shall be 100ml / M ~ 300ml / m. after indoor disinfection, the ground disinfection shall be sprayed again from the inside to the outside. The time of disinfection should not be less than 30 minutes.

(5) The surface of the object.

When there are visible pollutants on the surface of diagnosis and treatment facilities and equipment as well as bed fences, bedside  cabinets, furniture, door handles, household appliances, etc., thepollutants shall be completely removed before disinfection. When there is no visible pollutant, spray, wipe or soak with 1000mg / L effective chlorine disinfectant or 500mg / L chlorine dioxide disinfectant, and wipe with clean water after 30 minutes.

(6) Clothing, bedding and other textiles.

Aerosol should be avoided during collection. It is suggested to treat it as medical waste.

49E

S50

English:  http://dradama.com/docs/V-050e.jpg

Chinese:  http://dradama.com/docs/V-050.jpg

If there is no visible pollutant, if it needs to be reused, it can be sterilized by circulating steam or boiling for 30 minutes; or it can be soaked in 500mg / L effective chlorine containing disinfectant for 30 minutes, then it can be cleaned as usual; or it can be directly put into the washing machine after being packed in water-soluble bags, and it can be washed and sterilized for 30 minutes at the same time, The valuable clothes with effective chlorine content of 500mg / | can be disinfected with ethylene oxide.

(7) Hand hygiene

All personnel participating in the field work shall strengthen hand hygiene measures, and can choose alcohol containing quick drying hand disinfectant or alcohol compound quick drying hand disinfectant, or directly wipe with 75% alcohol for disinfection; for alcohol allergy, can choose effective non alcohol hand disinfectant such as quaternary ammonium salt; under special conditions, You can also use 3% hydrogen peroxide disinfectant, 0.5% lodophor or 0.05% chlorine disinfectant to wipe or soak your hands, and appropriately extend the disinfection time. In case of visible pollutants, wash hands with hand sanitizer under flowing water first, and then disinfect according to the above methods.

(8) Skin and mucous membrane.

When the skin is polluted by pollutants, the pollutants shall be removed immediately, and then the disposable absorbent materials shall be dipped with 0.5% lodophor or hydrogen peroxide disinfectant for more than 3 minutes, and then the skin shall be cleaned with clean water; the mucosa shall be washed with a large amount of normal saline or 0.05% iodophor.

(9) Food (drink) utensils.

After cleaning the food residue, boil and disinfect for 30 minutes, or soak in 500mg / L effective chlorine disinfectant for 30 minutes, and then wash with water.

(10) Means of transport and transfer.

50E

S51

English:  http://dradama.com/docs/V-051e.jpg

Chinese:  http://dradama.com/docs/V-051.jpg

The pollution situation shall be evaluated first. When there are visible pollutants in trains, cars and ships, the disposable water absorbing material shall be used to dip 5000mg / L ~ 10000mg / L of effective chlorine containing disinfectant (or the disinfectant wipes / dry wipes that can reach high level of disinfection) to completely remove the pollutants, and then the effective chlorine containing disinfectant 1000mg / L or the chlorine dioxide disinfectant 500mg / | shall be used for spraying or wiping disinfection, Clean with water after 30 minutes. When disinfecting the aircraft cabin, the type and dosage of disinfectant shall be in accordance with the relevant regulations of CAAC. It is suggested that fabrics, cushions, pillows and bed sheets should be treated as medical wastes.

(11) Patients’ domestic waste.

The patient's domestic waste shall be treated as medical waste. '

(12) Medical waste.

The disposal of medical waste shall comply with the requirements of the regulations on the management of medical waste and the measures for the management of medical waste of medical and health institutions, and shall be carried out in accordance with the regular disposal process after the double- layer yellow medical waste collection bag is used for packaging.

(13) Disposal of corpses.

After the death of the patient, the movement and handling of the corpse should be minimized as much as possible, which should be handled in time by the trained staff under strict protection. Use the effective chlorine containing disinfectant of 3000mg / L ~ 5000mg / L or 0.5% Peracetic Acid cotton ball or gauze to fill all open channels or wounds of the diseased population, nose, ear, anus, tracheotomy, etc.; use the double-layer cloth  single soaked with disinfectant to wrap the corpse in the double-layer corpse bag, and send the special vehicle sent by the Ministry of civil affairs directly to the designated place for cremation as soon as possible.

(14) Precautions.

51E

S52

English:  http://dradama.com/docs/V-052e.jpg

Chinese:  http://dradama.com/docs/V-052.jpg

Under the guidance of the local disease prevention and control the organization, the relevant units shall disinfect the site in time or the local disease prevention and control organization shall be responsible for disinfecting the site. The disinfection at any time and at the end of a the medical institution shall be carried out by a special person arranged by the medical institution, and the disease prevention and control institution shall provide technical guidance. Nonprofessional personnel shall receive professional training from local disease prevention and control institutions before carrying out disinfection work, take correct disinfection methods and do a good job of personal protection.

4, Evaluation of disinfection effect

If necessary, the disinfection effect of the object surface, air and hands shall be evaluated in time, which shall be carried out by the relevant laboratory personnel with inspection and testing qualifications.

(1) The surface of the object.

Sample the surface of objects before and after disinfection according to Appendix A of gb15982-2012 hygienic standard for hospital disinfection. The sample solution after disinfection is the corresponding neutralizer.

Generally, the evaluation of the disinfection effect is based on natural bacteria. If necessary, the indicator bacteria can also be used to evaluate the disinfection effect according to the actual situation. The resistance of the indicator bacteria should be equal to or greater than the resistance of existing pathogens. When the natural bacteria is taken as the index, the killing rate of the natural bacteria on the disinfected object after disinfection is = 90%, which can be regarded as qualified for disinfection; when the indicator bacteria is taken as the index, the killing rate of the indicator bacteria after disinfection is = 99.9%, which can be regarded as qualified for disinfection.

(2) Indoor air.

Air samples were taken before and after disinfection according to Appendix A of gb15982-2012 hygienic standard for hospital disinfection, and corresponding neutralizer was contained in the sampling plate after disinfection. After disinfection, the extinction rate of natural bacteria in the air = 90%, which can be judged as qualified.

(3) Staff hands.

52E

S53

English:  http://dradama.com/docs/V-053e.jpg

Chinese:  http://dradama.com/docs/V-053.jpg

According to Appendix A of gb15982-2012 hygienic standard for hospital disinfection, hand samples were taken before and after disinfection, and the sample solution after disinfection was the corresponding neutralizer. The killing  rate of natural bacteria on hands before and after disinfection is = 90%, which can be judged as qualified disinfection.

(4) Disinfection effect of hospital sewage.

According to gb18466 discharge standard of water pollutants for medical institutions Price.

E53

S54

English:  http://dradama.com/docs/V-054e.jpg

Chinese:  http://dradama.com/docs/V-054.jpg

Annex 6

Personal protection guidelines for specific groups of people

This guideline is used novel coronavirus pneumonia epidemic prevention and control work, to carry out epidemiological the investigation, staff in isolation wards and medical observation places, and professionals involved in cases and transshipment, corpse disposal, environmental cleaning and disinfection, specimen collection and laboratory work.

1, Personal protective equipment and use d 5 mp tom ati Conia cases and asy ,coronavirus pneumonia ; tions, vomit Novel cor ts (blood body fluids, secretions, infections, polulen i ll personnel on the surface of a and excreta, etc.) a - environmental surfaces should be i articles 0 contaminated ‘oment . ctive equip . used in personal prote

(1) gloves

When entering the contaminated area or carrying out diagnosis and treatment operation, wear disposable rubber or nitrile gloves according to the work content, disinfect in time when contacting different patients or gloves damaged, replace the gloves and conduct hand hygiene.

(2) Medical protective mask.

When entering the contaminated area or carrying out diagnosis and treatment operation, the medical protective mask or powered air supply filter respirator shall be worn, and the air tightness inspection shall be carried out before wearing each time. When wearing multiple protective articles, it is necessary to ensure that the medical protective mask is finally removed.

(3) Protective screen or goggles.

Enter the contaminated area or carry out diagnosis and treatment operations. There are covers on eyes, conjunctiva and face

E54

S55

English:  http://dradama.com/docs/V-055e.jpg

Chinese:  http://dradama.com/docs/V-055.jpg

When there is a risk of contamination of bI66d, body fluids, secretions, excreta and aerosols, a protective screen or goggles shall be worn. The reused goggles shall be disinfected and dried in time after each use for standby.

(4) Protective clothing.

When entering the contaminated area or carrying out diagnosis and treatment, personal clothes shall be changed and work clothes (surgical hand washing clothes or disposable clothes, etc.) shall be worn, plus protective clothing.

Secondhand hygiene

All personnel participating in the fieldwork shall strengthen the hand hygiene measures, and can choose alcohol-containing quick drying hand disinfectant or alcohol compound quick-drying hand disinfectant, or directly use 75% alcohol to wipe and disinfect alcohol allergy, and can choose effective non-alcohol hand disinfectant such as quaternary ammonium salt; under special conditions, You can also use 3% hydrogen peroxide disinfectant, 0.5% iodophor or 0.05% chlorine disinfectant to wipe or soak your hands, and appropriately extend the disinfection time. In the case of visible pollutants, wash hands with hand sanitizer under flowing water first, and then disinfect according to the above methods.

In daily work, hand hygiene measures should be strictly taken, especially before wearing gloves and personal protective equipment, before aseptic operation of patients, after possible contact with patients’ blood, body fluids and their pollutants or environmental! surfaces, when removing personal protective equipment, special attention should be paid to the implementation of hand hygiene measures.

3. Personal protection for a specific population

(1) Epidemiological investigators.

When investigating close contacts, wear disposable work cap, medical-surgical mask, work clothes and disposable gloves, and keep a distance of more than 1 meter from the respondents.

55E

S56

English:  http://dradama.com/docs/V-056e.jpg

Chinese:  http://dradama.com/docs/V-056.jpg

When investigating suspected and confirmed cases and asymptomatic infected persons, it is recommended to wear work clothes, disposable work caps, disposable gloves, protective clothing, kn95 / N95 and above particle protective masks or medical protective masks, protective screens or goggles, work shoes or rubber boots, waterproof boots, etc.

(2) staff in isolation ward and medical observation place.

It is recommended to wear work clothes, disposable work caps, disposable gloves, protective clothing, medical protective masks or powered air supply filter respirators, protective screens or goggles, work shoes or rubber boots, waterproof boot covers, etc.

(3) Case and asymptomatic carriers.

It is recommended to wear work clothes, disposable work caps, disposable gloves, protective clothing, medical protective masks or powered air supply filter respirators, protective screens or goggles, work shoes or rubber boots, waterproof boot covers, etc.

(4) Body handler.

It is recommended to wear work clothes, disposable work caps, disposable gloves and long sleeve thickened rubber gloves, protective clothing, kn95 / N95 and above particle protective masks or medical protective masks or powered air supply filter respirators, protective screens, work shoes or rubber boots, waterproof boot covers, waterproof aprons or waterproof isolation clothing.

5) Environmental cleaning and disinfection personnel.

It is recommended to wear work clothes, disposable work caps, disposable gloves and long sleeve thickened rubber gloves, protective clothing, kn95 / N95 and above particle protective masks or medical protective mouth or powered air supply filter respirators, protective screens, work shoes or rubber boots, waterproof boot covers, waterproof aprons or waterproof isolation clothing, and use powered air supply filter breathing

56E

S57

English:  http://dradama.com/docs/V-057e.jpg

Chinese:  http://dradama.com/docs/V-067.jpg

When using the sterilizer, the filter box or canister of dust and poison combination shall be selected according to the type of disinfectant to protect the disinfectant and other chemicals.

(6) Specimen collector.

It Is recommended to wear work clothes, disposable work caps, double-layer gloves, protective clothing Kn95 / N95 and above particle protective mask or medical protective mask or powered air supply filter respirator, protective screen, working shoes or rubber boots, waterproof boot cover. If necessary, wear a waterproof apron or waterproof isolation clothing.

7) Laboratory staff

It is recommended to wear at least work clothes, disposable work caps, double-layer gloves, protective clothing, kn95 / N95 and above particle protective masks or medical protective masks or powered air supply filter respirators, protective screens or goggles, work shoes or rubber boots, and waterproof boot covers. If necessary, wear waterproof apron or waterproof isolation clothing.

4, Precautions for removing protective equipment

(1) When unloading, try to avoid contacting the contaminated surface.

(2) They removed protective goggles, long and simple rubber shoes and other nondisposable articles shall be directly put into the container containing disinfectant to be soaked; the other disposable articles shall be put into the Yellow medical waste collection bag for centralized disposal as medical waste.

(3) Hand disinfection shall be carried out for each step of removing protective equipment, and handwashing and hand disinfection shall be carried out again after all protective equipment is removed.

E57